Info

CGG repeats cggcggcggcggcggcgg... gccgccgccgccgccgcc...

Offspring DNA

Premutated allele: There are not enough triplets to cause fragile-X syndrome, but they may expand in the next generation.

Defective allele

cggcggcggcggcggcggcggcggcgt gccgccgccgccgccgccgccgccgct

Fragile-X allele: There are many more triplets than normal; this condition causes mental retardation.

17.9 The CGG Repeat in the Fragile-X Gene Expands with Each Generation The genetic defect in fragile-X syndrome is caused by 200 or more repeats of the CGG triplet.

ple with fragile-X syndrome, the CGG sequence is repeated 200 to 2,000 times.

The "premutated" males that show no symptoms, but have affected descendants, have 52 to 200 repeats. These repeats become more numerous as the daughters of these men pass the chromosome on to their children (Figure 17.9). Expansion to more than 200 repeats leads to increased methylation of the cytosines in the CGG units, accompanied by transcriptional inactivation of the FMR1 gene. The normal role of the protein product of this gene is to bind to mRNAs involved in nerve cell function and regulate their translation at the ribosome. When the FMR1 protein is not made in adequate amounts, these mRNAs are not properly translated, and nerve cells die. Their loss often results in mental retardation.

Such expanding triplet repeats have been found in over a dozen other diseases, such as myotonic dystrophy (involving repeated CTG triplets) and Huntington's disease (in which CAG is repeated). Many benign genes also appear to have these repeats, which may be found within a protein-coding region or outside it. How the repeats expand is not known, but DNA polymerase may slip after copying a repeat and then fall back to copy it again. In all previously known classes of human mutations, the mutation is just as stable as the normal allele, but expanding triplet repeats represent an entirely new class of unstable mutant alleles.

Was this article helpful?

0 0
Essentials of Human Physiology

Essentials of Human Physiology

This ebook provides an introductory explanation of the workings of the human body, with an effort to draw connections between the body systems and explain their interdependencies. A framework for the book is homeostasis and how the body maintains balance within each system. This is intended as a first introduction to physiology for a college-level course.

Get My Free Ebook


Post a comment